Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2399087
End position: 2399122
Length: 36

DNA sequence
>NC_016622, from 2399087 to 2399122 (36 bp); Azospirillum lipoferum 4B GTCGTTGGCGGCGGCGTTGGCCGCATCGTTGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2398599-2401706	Sequence	AZOLI_2536 - Hybrid sensor histidine kinase (Protein is coded in complementary strand; from 2401706 to 2398599)