Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2442417
End position: 2442461
Length: 45

DNA sequence
>NC_016622, from 2442417 to 2442461 (45 bp); Azospirillum lipoferum 4B GGACGGGGTGGCGGAGGACGGGGTGGCGGAGGACGGGGTGGCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2441659-2442966	Sequence	AZOLI_2578 - putative diguanylate phosphodiesterase (EAL domain) (Protein is coded in complementary strand; from 2442966 to 2441659)