Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 245231
End position: 245275
Length: 45

DNA sequence
>NC_016622, from 245231 to 245275 (45 bp); Azospirillum lipoferum 4B TTCCGCCTTCTCCGTTTCGGACTTCTCAGTTTCCGACTTCGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 244017-245774	Sequence	AZOLI_0253 - hypothetical protein (Protein is coded in complementary strand; from 245774 to 244017)