Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2542420
End position: 2542443
Length: 24

DNA sequence
>NC_016622, from 2542420 to 2542443 (24 bp); Azospirillum lipoferum 4B CCACCGGCACCGCCAACGCCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2541312-2543840	Sequence	AZOLI_2694 fixI cation-exporting ATPase (Protein is coded in complementary strand; from 2543840 to 2541312)