Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2571293
End position: 2571316
Length: 24

DNA sequence
>NC_016622, from 2571293 to 2571316 (24 bp); Azospirillum lipoferum 4B CGGCGGCGACGGCGTCGGCGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2571100-2571678	Sequence	AZOLI_2724 - hypothetical protein (Protein is coded in complementary strand; from 2571678 to 2571100)