Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2591317
End position: 2591361
Length: 45

DNA sequence
>NC_016622, from 2591317 to 2591361 (45 bp); Azospirillum lipoferum 4B TTAGTCCCGGCGCCGCTATTCCCGGCGCCTTTAGTTTGGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2591348-2592643	Sequence	AZOLI_2747 rsmB Ribosomal RNA small subunit methyltransferase B (Protein is coded in complementary strand; from 2592643 to 2591348)