Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2668124
End position: 2668159
Length: 36

DNA sequence
>NC_016622, from 2668124 to 2668159 (36 bp); Azospirillum lipoferum 4B CGCGACGGTCGCCGTGGCGGTCGCCGTGACGGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2667682-2668185	Sequence	AZOLI_2838 - putative DNA polymerase III (Protein is coded in complementary strand; from 2668185 to 2667682)