Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 268414
End position: 268449
Length: 36

DNA sequence
>NC_016622, from 268414 to 268449 (36 bp); Azospirillum lipoferum 4B CCTCGACCTTGGCCTCTACCTTCGCTTCAACCTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 268146-268826	Sequence	AZOLI_0280 - hypothetical protein (Protein is coded in complementary strand; from 268826 to 268146)