Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2798449
End position: 2798472
Length: 24

DNA sequence
>NC_016622, from 2798449 to 2798472 (24 bp); Azospirillum lipoferum 4B CCGGGTCCCGGTCGGGGTCCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2798130-2799869	Sequence	AZOLI_2971 - hypothetical protein (Protein is coded in complementary strand; from 2799869 to 2798130)