Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2828656
End position: 2828685
Length: 30

DNA sequence
>NC_016622, from 2828656 to 2828685 (30 bp); Azospirillum lipoferum 4B CCGCCAGCGCCACCGCCGCCGCCCCGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2827512-2828825	Sequence	AZOLI_3006 pstA2 phosphate ABC transporter, permease component (Protein is coded in complementary strand; from 2828825 to 2827512)