Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2873790
End position: 2873813
Length: 24

DNA sequence
>NC_016622, from 2873790 to 2873813 (24 bp); Azospirillum lipoferum 4B CAGCGGCAGCAGCAGCGCCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2872687-2874102	Sequence	AZOLI_3057 cycH Cytochrome c-type biogenesis protein cycH (Protein is coded in complementary strand; from 2874102 to 2872687)