Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2897759
End position: 2897803
Length: 45

DNA sequence
>NC_016622, from 2897759 to 2897803 (45 bp); Azospirillum lipoferum 4B CGTCTTTCAGGCCATCGACTTTCAGGCTGTCGTCTTTCAGGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2897796-2898752	Sequence	AZOLI_3084 - putative divalent cation transporter (Hemolysin and CBS domains) (Protein is coded in complementary strand; from 2898752 to 2897796)