Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2899854
End position: 2899877
Length: 24

DNA sequence
>NC_016622, from 2899854 to 2899877 (24 bp); Azospirillum lipoferum 4B CAGCGCCACCGCCTGCGCCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2899252-2900361	Sequence	AZOLI_3086 - putative phosphate starvation-inducible protein, PhoH-like (Protein is coded in complementary strand; from 2900361 to 2899252)