Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2920581
End position: 2920607
Length: 27

DNA sequence
>NC_016622, from 2920581 to 2920607 (27 bp); Azospirillum lipoferum 4B GCCGATGACGCCGATGGCGCCGATCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2920504-2921544	Sequence	AZOLI_3111 hrcA Heat-inducible transcription repressor (Protein is coded in complementary strand; from 2921544 to 2920504)