Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 371369
End position: 371392
Length: 24

DNA sequence
>NC_016622, from 371369 to 371392 (24 bp); Azospirillum lipoferum 4B CGTCGCCCTCGCCTTCGCCCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 370513-373602	Sequence	AZOLI_0386 rne Ribonuclease E (Protein is coded in complementary strand; from 373602 to 370513)