Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 702683
End position: 702718
Length: 36

DNA sequence
>NC_016622, from 702683 to 702718 (36 bp); Azospirillum lipoferum 4B CGCACCCATCCCGGCGCCCATCCCGGCGCCCATCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 701865-703463	Sequence	AZOLI_0748 - hypothetical protein (Protein is coded in complementary strand; from 703463 to 701865)