Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 835921
End position: 835944
Length: 24

DNA sequence
>NC_016622, from 835921 to 835944 (24 bp); Azospirillum lipoferum 4B AGGGCGAGGCCGAGCGCGATGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 835330-836247	Sequence	AZOLI_0901 dppB4 Dipeptide ABC transporter, permease component (Protein is coded in complementary strand; from 836247 to 835330)