Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 842037
End position: 842081
Length: 45

DNA sequence
>NC_016622, from 842037 to 842081 (45 bp); Azospirillum lipoferum 4B GGCGGTGAGATCTGGGGCGGTGAGATCTGGGGCCGTGAAACCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 841956-842438	Sequence	AZOLI_0907 - hypothetical protein (Protein is coded in complementary strand; from 842438 to 841956)