Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 866694
End position: 866729
Length: 36

DNA sequence
>NC_016622, from 866694 to 866729 (36 bp); Azospirillum lipoferum 4B ATCAGCGGGGAGGGCAGCGGGGAGGGCAGCGGGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 865364-866695	Sequence	AZOLI_0936 - type I secretion membrane fusion protein (HlyD family) (Protein is coded in complementary strand; from 866695 to 865364)
ORF. 866692-868467	Sequence	AZOLI_0937 - ABC transporter, ATPase component (Type I toxin/protease secretion system) (Protein is coded in complementary strand; from 868467 to 866692)