Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 886051
End position: 886074
Length: 24

DNA sequence
>NC_016622, from 886051 to 886074 (24 bp); Azospirillum lipoferum 4B GGGTGCCGGTGCGGGTGCGGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 885959-887284	Sequence	AZOLI_0961 - hypothetical protein (Protein is coded in complementary strand; from 887284 to 885959)