Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 916091
End position: 916146
Length: 56

DNA sequence
>NC_016622, from 916091 to 916146 (56 bp); Azospirillum lipoferum 4B TGCAAGTCCGTTGGCGCAAGCCCGTTGGCGCAAGTCCGTTGGCGCAAGTCCGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 916012-916230	Sequence	AZOLI_0989 - hypothetical protein (Protein is coded in complementary strand; from 916230 to 916012)