Sequence retrieval

Genome: Marinitoga piezophila KA3
Start position: 1204957
End position: 1204980
Length: 24

DNA sequence
>NC_016751, from 1204957 to 1204980 (24 bp); Marinitoga piezophila KA3 TATCTTTATCCTTATCTATATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1203222-1205930	Sequence	Marpi_1169 - hypothetical protein (Protein is coded in complementary strand; from 1205930 to 1203222)