Sequence retrieval

Genome: Marinitoga piezophila KA3
Start position: 1227929
End position: 1227968
Length: 40

DNA sequence
>NC_016751, from 1227929 to 1227968 (40 bp); Marinitoga piezophila KA3 ATATTTTTTTATGTTTTCTTTTATTTTTTCATAGTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1227495-1228559	Sequence	Marpi_1194 - nucleoside-diphosphate-sugar epimerase (Protein is coded in complementary strand; from 1228559 to 1227495)