Sequence retrieval

Genome: Marinitoga piezophila KA3
Start position: 1309053
End position: 1309100
Length: 48

DNA sequence
>NC_016751, from 1309053 to 1309100 (48 bp); Marinitoga piezophila KA3 GCTGCAATCCTTGTTGTAATCCTTGTTGTAATCCTTGCTGTAATCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1308866-1309945	Sequence	Marpi_1270 - flagellar biosynthesis/type III secretory pathway protein (Protein is coded in complementary strand; from 1309945 to 1308866)