Sequence retrieval

Genome: Marinitoga piezophila KA3
Start position: 1362281
End position: 1362304
Length: 24

DNA sequence
>NC_016751, from 1362281 to 1362304 (24 bp); Marinitoga piezophila KA3 CAGGAAGAGGAATAGGAAAAGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1361884-1362381	Sequence	Marpi_1316 - hypothetical protein (Protein is coded in complementary strand; from 1362381 to 1361884)