Sequence retrieval

Genome: Marinitoga piezophila KA3
Start position: 1374366
End position: 1374390
Length: 25

DNA sequence
>NC_016751, from 1374366 to 1374390 (25 bp); Marinitoga piezophila KA3 AAAAAAAGAAATAAAAAAATTAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1374008-1375330	Sequence	Marpi_1330 - response regulator with CheY-like receiver, AAA-type ATPase, and DNA-binding domains