Sequence retrieval

Genome: Marinitoga piezophila KA3
Start position: 1790020
End position: 1790049
Length: 30

DNA sequence
>NC_016751, from 1790020 to 1790049 (30 bp); Marinitoga piezophila KA3 AATAGAAATAGAAAGAGATATAGAAAGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1789194-1793930	Sequence	Marpi_1720 - DNA-directed RNA polymerase, beta' subunit/160 kD subunit