Sequence retrieval

Genome: Marinitoga piezophila KA3
Start position: 1875507
End position: 1875542
Length: 36

DNA sequence
>NC_016751, from 1875507 to 1875542 (36 bp); Marinitoga piezophila KA3 TCTTCTTTACCTTCTTTTCTACCTTCTTTTCTACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1875333-1876376	Sequence	Marpi_1798 - hypothetical protein (Protein is coded in complementary strand; from 1876376 to 1875333)