Sequence retrieval

Genome: Marinitoga piezophila KA3
Start position: 2013447
End position: 2013474
Length: 28

DNA sequence
>NC_016751, from 2013447 to 2013474 (28 bp); Marinitoga piezophila KA3 TTTAAATTTTAGATTTTAGATTTTAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2013463-2015448	Sequence	Marpi_1927 - methyl-accepting chemotaxis protein (Protein is coded in complementary strand; from 2015448 to 2013463)