Sequence retrieval

Genome: Marinitoga piezophila KA3
Start position: 207452
End position: 207481
Length: 30

DNA sequence
>NC_016751, from 207452 to 207481 (30 bp); Marinitoga piezophila KA3 AAATGTTTTTATCTGTTTTTAAATCTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 207247-208614	Sequence	Marpi_0205 - hypothetical protein (Protein is coded in complementary strand; from 208614 to 207247)