Sequence retrieval

Genome: Marinitoga piezophila KA3
Start position: 210443
End position: 210467
Length: 25

DNA sequence
>NC_016751, from 210443 to 210467 (25 bp); Marinitoga piezophila KA3 TCTTTTCCTTTGTTTTCTTTTGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 209690-211417	Sequence	Marpi_0207 - multidrug ABC transporter ATPase and permease (Protein is coded in complementary strand; from 211417 to 209690)