Sequence retrieval

Genome: Marinitoga piezophila KA3
Start position: 2155506
End position: 2155530
Length: 25

DNA sequence
>NC_016751, from 2155506 to 2155530 (25 bp); Marinitoga piezophila KA3 TTTTTTTGTTTTCTTTTTTTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2155130-2155657	Sequence	Marpi_2047 - hypothetical protein (Protein is coded in complementary strand; from 2155657 to 2155130)