Sequence retrieval

Genome: Marinitoga piezophila KA3
Start position: 704617
End position: 704640
Length: 24

DNA sequence
>NC_016751, from 704617 to 704640 (24 bp); Marinitoga piezophila KA3 TTTCATTGTCATTGTCATTATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 703514-705385	Sequence	Marpi_0693 - anaerobic ribonucleoside-triphosphate reductase (Protein is coded in complementary strand; from 705385 to 703514)