Sequence retrieval

Genome: Marinitoga piezophila KA3
Start position: 857364
End position: 857388
Length: 25

DNA sequence
>NC_016751, from 857364 to 857388 (25 bp); Marinitoga piezophila KA3 TTTTTTATTTTTTTCTCTTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 857359-857754	Sequence	Marpi_0847 - protein with tetrapyrrole methyltransferase and pyrophosphatase domains (Protein is coded in complementary strand; from 857754 to 857359)