Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 1797576
End position: 1797599
Length: 24

DNA sequence
>NC_016782, from 1797576 to 1797599 (24 bp); Corynebacterium diphtheriae 241 CAGGCGCAGGGGCAGGCGCAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1797158-1797775	Sequence	CD241_1703 - putative secreted protein (Protein is coded in complementary strand; from 1797775 to 1797158)