Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 1912162
End position: 1912185
Length: 24

DNA sequence
>NC_016782, from 1912162 to 1912185 (24 bp); Corynebacterium diphtheriae 241 CTGCGCCTGCGCCAGCGCCTGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1911477-1912490	Sequence	CD241_1804 - ferrichrome transport system permease protein fhuB (Protein is coded in complementary strand; from 1912490 to 1911477)