Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 192698
End position: 192721
Length: 24

DNA sequence
>NC_016782, from 192698 to 192721 (24 bp); Corynebacterium diphtheriae 241 GAGCCGAAGCCGGAACCGAAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 191433-193562	Sequence	CD241_0213 - DNA polymerase III subunits gamma and tau