Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 2286509
End position: 2286532
Length: 24

DNA sequence
>NC_016782, from 2286509 to 2286532 (24 bp); Corynebacterium diphtheriae 241 CTTCGGCTGCGGCTGCGGCTTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2285887-2287377	Sequence	CD241_2141 - putative sodium/alanine symporter (Protein is coded in complementary strand; from 2287377 to 2285887)