Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 2383040
End position: 2383066
Length: 27

DNA sequence
>NC_016782, from 2383040 to 2383066 (27 bp); Corynebacterium diphtheriae 241 GCGGGTGCTGCTGGTGCTGCGGGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2381589-2383151	Sequence	CD241_2218 ulaA ascorbate-specific PTS system enzyme IIC