Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 532155
End position: 532181
Length: 27

DNA sequence
>NC_016782, from 532155 to 532181 (27 bp); Corynebacterium diphtheriae 241 CTGGAAGGCATGGAAGGCGTGGAAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 532008-533465	Sequence	CD241_0545 mscS small-conductance mechanosensitive channel (Protein is coded in complementary strand; from 533465 to 532008)