Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 102140
End position: 102169
Length: 30

DNA sequence
>NC_016782, from 102140 to 102169 (30 bp); Corynebacterium diphtheriae 241 CGCGCCCACCAGCGCCCACCAGTGCCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 102060-102215	Sequence	CD241_0118 - hypothetical protein (Protein is coded in complementary strand; from 102215 to 102060)