Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 1992800
End position: 1992829
Length: 30

DNA sequence
>NC_016782, from 1992800 to 1992829 (30 bp); Corynebacterium diphtheriae 241 ACGCCCACCAGCACCCACCAACGCCCACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1992632-1992814	Sequence	CD241_1880 - hypothetical protein (Protein is coded in complementary strand; from 1992814 to 1992632)