Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 2205144
End position: 2205173
Length: 30

DNA sequence
>NC_016782, from 2205144 to 2205173 (30 bp); Corynebacterium diphtheriae 241 CGCCCACCAACGCCCACCAACGCCAGCCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2205026-2205214	Sequence	CD241_2073 - hypothetical protein (Protein is coded in complementary strand; from 2205214 to 2205026)