Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 2361908
End position: 2361940
Length: 33

DNA sequence
>NC_016782, from 2361908 to 2361940 (33 bp); Corynebacterium diphtheriae 241 GCTCACGCACCCCTCACGCACCCCTCACGCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2361933-2363633	Sequence	CD241_2204 - hypothetical protein (Protein is coded in complementary strand; from 2363633 to 2361933)