Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 193028
End position: 193063
Length: 36

DNA sequence
>NC_016782, from 193028 to 193063 (36 bp); Corynebacterium diphtheriae 241 CCGGAGCCTAAGCCGGAGCCCAAGCCCGAGCCCAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 191433-193562	Sequence	CD241_0213 - DNA polymerase III subunits gamma and tau