Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 1980843
End position: 1980878
Length: 36

DNA sequence
>NC_016782, from 1980843 to 1980878 (36 bp); Corynebacterium diphtheriae 241 CGACTCTGTCGACTCTGCCGACTCGGTCGACTCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1980103-1981512	Sequence	CD241_1869 - putative secreted protein (Protein is coded in complementary strand; from 1981512 to 1980103)