Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 2392431
End position: 2392469
Length: 39

DNA sequence
>NC_016782, from 2392431 to 2392469 (39 bp); Corynebacterium diphtheriae 241 TATCGCGCTAGGCTATCGCGCTAGGCTATCGCGCTAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2392465-2393709	Sequence	CD241_2229 - putative integral membrane transport protein (Protein is coded in complementary strand; from 2393709 to 2392465)