Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 1946000
End position: 1946039
Length: 40

DNA sequence
>NC_016782, from 1946000 to 1946039 (40 bp); Corynebacterium diphtheriae 241 CGCCCACCAACGCCCACCAGCGCACACCAACGCACACCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1945765-1946058	Sequence	CD241_1836 - hypothetical protein (Protein is coded in complementary strand; from 1946058 to 1945765)