Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 281777
End position: 281816
Length: 40

DNA sequence
>NC_016782, from 281777 to 281816 (40 bp); Corynebacterium diphtheriae 241 CACCAACGCCCACCAACGCCCACCAACGCCCACCAACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 281647-281823	Sequence	CD241_0297 - hypothetical protein (Protein is coded in complementary strand; from 281823 to 281647)