Sequence retrieval

Genome: Corynebacterium diphtheriae 241
Start position: 1945989
End position: 1946038
Length: 50

DNA sequence
>NC_016782, from 1945989 to 1946038 (50 bp); Corynebacterium diphtheriae 241 GCGCACACCAACGCCCACCAACGCCCACCAGCGCACACCAACGCACACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1945765-1946058	Sequence	CD241_1836 - hypothetical protein (Protein is coded in complementary strand; from 1946058 to 1945765)